EX-99.1 2 exhibit_99-1.htm EXHIBIT 99.1
Exhibit 99.1

 Company PresentationSeptember 2020  A subsidiary of 
 
   Forward Looking Statement  This presentation contains "forward-looking statements" relating to future events, and we may from time to time make other statements, regarding our outlook or expectations for future financial or operating results and/or other matters regarding or affecting Evogene Ltd. or its subsidiaries, including Canonic Ltd. (“Subsidiary” or “Company”) (collectively, “Evogene” or “we”), that are considered “forward-looking statements” as defined in the U.S. Private Securities Litigation Reform Act of 1995 (the “PSLRA”) and other securities laws. Such forward-looking statements may be identified by the use of such words as “believe”, “expect”, “anticipate”, “should”, “planned”, “estimated”, “intend” and “potential” or words of similar meaning. Canonic is using forward-looking statements in this presentation when it discusses its near-term value drivers, including statements to the effect that it will reach commercialization, its estimated market size, its short-term milestones and commercial milestones. For these statements, Evogene and Subsidiary claim the protection of the safe harbor for forward-looking statements contained in the PSLRA and other securities laws.Such statements are based on current expectations, estimates, projections and assumptions, describe opinions about future events, involve certain risks and uncertainties which are difficult to predict and are not guarantees of future performance. Therefore, actual future results, performance or achievements, and trends in the future of Subsidiary and Evogene may differ materially from what is expressed or implied by such forward-looking statements due to a variety of factors, many of which are beyond Subsidiary's and Evogene's control, including, without limitation, those described in greater detail in Evogene's Annual Report on Form 20-F and in other information it files and furnishes with the Israel Securities Authority and the U.S. Securities and Exchange Commission, including those factors under the heading “Risk Factors”.All written and oral forward-looking statements attributable to us or persons acting on our behalf are expressly qualified in their entirety by the previous statements. Except for any obligations to disclose information as required by applicable securities laws, Subsidiary and Evogene disclaim any obligation or commitment to update any information contained in this presentation or to publicly release the results of any revisions to any statements that may be made to reflect future events or developments or changes in expectations, estimates, projections and assumptions.The information contained herein does not constitute a prospectus or other offering document, nor does it constitute or form part of any invitation or offer to sell, or any solicitation of any invitation or offer to purchase or subscribe for, any securities of Evogene or Subsidiary, nor shall the information or any part of it or the fact of its distribution form the basis of, or be relied on in connection with, any action, contract, commitment or relating thereto or to the securities of Evogene or Subsidiary.The trademarks included herein are the property of the owners thereof and are used for reference purposes only. Such use should not be construed as an endorsement of the products or services of Evogene or Subsidiary.  2 
 
 OUR VISION  Commercialize effective,precise and stable medicalcannabis products foroptimized therapeutic impact      3 
 
 INTRODUCTION  4 
 
   Company Overview  5  Founded in 2019 as a spinoff from Evogene Ltd (EVGN)  We aim to develop & commercialize medical cannabis products  We aim to bring products all the way to the market starting from genetics to reach patients  Our products under development are based on stable high yield plants with optimized therapeutic effects  AI –based computational platform seeks to empower our plant breeding pipeline  Commercialization is expected in early 2022, up to 4 products in the following 3 years 
 
     6  Global Cannabis Market  Medical cannabis is >60% of the global market(source: prohibition partners Nov 2019)    Global Spending by Region (In Billions) 
 
       Market Challenges & The Opportunity  THE CHALLENGES  7  SPECIFICITY  Specific medical indicationsrequire tailored activecompound profiles.To date, breeding efforts in the market mainlypushed THC levels  YIELD  Legalization is driving steep declines in market prices, giving advantage to high yield products  STABILITY  Substantial variationswithin varieties produceinconsistent products andtherefore inconsistent results  THE OPPORTUNITY- PLANT GENETICS MAY HOLD THE SOLUTION TO THE INDUSTRY’S BIGGEST CHALLENGES 
 
       Canonic TechnologyPowered By Evogene’s GeneRator AI  CUTTING EDGE AI DRIVEN COMPUTATIONAL GENOMIC POWER TO TACKLE INDUSTRY CHALLENGES  8         
 
     Cannabis Value Chain  FROM GENOMICS TO PRODUCT  9  VarietiesDevelopment  R&D Facilities  Distribution  RegionalDistributers  Seeds & SeedlingProduction  PropagationFarms  Sales& Marketing  Pharmacies & WebPlatforms  Extraction &Formulation  Extractors &Formulators  CannabisCultivation  Cultivators  Patients  ACTIVITY               
 
     Canonic in the Cannabis Value Chain  Quickly and cost effectively reach the end user, by leveraging proprietarygenomic expertise and outsourcing downstream elements of the value chain  10  Patients  VarietiesDevelopment  R&D Facilities  Distribution  RegionalDistributers  Seeds & SeedlingProduction  PropagationFarms  Sales& Marketing  Pharmacies & WebPlatforms  Extraction &Formulation  Extractors &Formulators  CannabisCultivation  Cultivators  CONTRACTORS  ACTIVITY               
 
     One Stop ShopFrom Genomics to Medical Cannabis Products  Quickly and cost effectively reach the end user, by leveraging proprietarygenomic expertise and outsourcing downstream elements of the value chain  11  Patients  VarietiesDevelopment  R&D Facilities (Operational)  Distribution  RegionalDistributers  Seeds & SeedlingProduction  PropagationFarm (2020)  Sales& Marketing  Pharmacies & WebPlatforms  Extraction &Formulation  Extraction &Formulation  CannabisCultivation  Cultivators  ACTIVITY                (frame agreements signed)  (initial contact) 
 
 PRODUCTS   12 
 
     Product Families Under Development  13  Increased compounds per area [e.g. Dwarf & early flowering]  Increased compounds per plant[e.g. Increased trichomes prevalence]   MetaYield+ Stable enhancement of total plant compounds.Focus on agronomic and consumer traits.   Compound profile focus [e.g. CBG, CBC]  Medical indication focus [e.g. Pain & Inflammation]  Precise+ Stable enhancement of specific active compounds.Focus on therapeutic traits.                         
 
   MetaYield+ : First Commercial Product  14  Canonic expects to commercialize its first varieties during 2022  High THC  PRODUCT NAME- NOA 1   Status:product development                   Expected launch in Israel:early 2022   Relevant market segment:T20/C5           High yield   Big inflorescence  Dense trichomes  Target markets: Israel (170M$*) & EU          *Company estimate, based on current market sale prices and data published by Israeli Health Ministry regarding number of medical cannabis users in Israel  
 
   MetaYield+ : Second Commercial Product   15  Canonic expects to commercialize its first varieties during 2022  High THC  PRODUCT NAME- NOA 2   Status:product development                   Expected launch in Israel:early 2022   Relevant market segment:T20/C5           High yield   Big inflorescence          *Company estimate, based on current market sale prices and data published by Israeli Health Ministry regarding number of medical cannabis users in Israel   Target markets: Israel (170M$*) & EU 
 
   Introduction to Precise+ Product Family  16  Medical indication focus     We generate pre-clinical data to guide our breeding program towards specific medical indications   Chronic pain  Inflammation                       
 
   Next Generation Products   17  Canonic is developing and validating its varieties in collaboration with leading research centers   Indication: Inflammation  Product 1  Pre clinical study: Hadassah medical center  Status: product development   Expected launch in Israel: 2023  Indication: Pain  Product 2  Pre clinical study: Migal research center  Status: product development   Expected launch in Israel: 2023      Target market size in Israel (2023):217 M$*  Target market size in Israel (2023):70M$*  *Company estimate, based on current market sale prices and data published by Israeli Health Ministry regarding number of medical cannabis users in Israel per medical indication  
 
 Technology  18 
 
   End-to-End Technologies  19  Developing in Israel’s top cannabis R&D facilities   Large genetic & breeding collections  In house propagation   State of the art phenotypic tools  Fully equipped labs & tissue culture rooms  In-house Advanced-breeding   World leading computational capabilities  
 
     Unique Proprietary Database  Quality, Quantity and Variety of Information  Evogene’s plant genomics database  Proprietary Cannabis genomic & chemical data  Pre-clinical and clinical data      Cannabis tailored unique database  MetaYield+    20        Precise+  
 
     - Advanced Breeding Technologies  Re-engineering traditional Cannabis breeding- Computational Technology  21          Computational genomics  Proprietary Comparative Genomics    ATTTCCGCACAAGGATTAGT  Novel Genes & Markers (IP protected)  ATCGCTTCACATAGGAAGT  Functional Cannabinoids patterns  THC / CBD / CBG / ……  High throughput plant breeding  Pre-Clinical trials  Computed phenotyping   Genetic markers assisted selection  MetaYield+  Precise+         Unique database 
 
                 Cutting-Edge Technology Addressing Market Challenges  22  Stability  Specificity   Yield   Reduced genetic variation   Diverse extracts for pre-clinical assays   Increased trichome density  
 
 Summary  23 
 
 Guy Adler Product manager & business development     Team  24    Dr. Arnon HeymanCEO  Dr. Inbal Dangoor Head of R&D    Aviv FilhaberAgronomist   Dr. Michi BrogPlant breeder                       Barel TalTechnician      
 
   Team  25  Ofer Haviv Chairman of the board   Board of directors   Evogene CEO and President   Raanan CohenBusiness strategy   Former CEO Koor industries   Dr. Yossi TamCannabinoid clinical research   Director, Multidisciplinary Center for Cannabinoid Research of the Hebrew university  Dr. Yariv BrotmanPlant metabolic pathways   Ben Gurion University & Max Planck institute of Molecular Plant Physiology   Dorit KreinerFinance  Evogene CFO  Nirit ElyovichMarketing strategy   Senior marketing specialist with over 20 years of B2C experience in various markets  Shai LeviatovPlant breeding   Commercial varieties breeding for more than 30 years in top leading multinational seeds companies.   Adv. Itay Rosenferld Business strategy   Advisors                                  Cannabis entrepreneur and former BOD member of Intelicanna (TLV:INTL) 
 
   Short Term Milestones  26  2020  Conduct pre-clinical studies to support the development of Canonic’s medical cannabis products.Demonstrate yield improvement incannabis lines under development.Engagement with commercial partners for cultivation and production.    2021  Pre-commercial activity with firstcannabis variety towards commercialization in 2022.Demonstrate clinical effects of Canonic varieties based on dedicated research with a medical institution.   
 
   Anticipated Commercial Milestones (5y)  27      Establishment  POC & Go to Market   MetaYield+ Pre- Commercial   MetaYield+ Commercial  Precise+ market entry   Market expansion – N. America  2019  2020  2021  2022        Market expansion – N. America       1  2  3  4  5  6  Infrastructure, seed collection & cultivation    Go to Market    Initial sales    2023  2024  2025  Market entry  IL, EU  IL, EU, N. America       
 
   Summary   28  Canonic aims to develop and commercialize medical grade Cannabis through a revolutionary genomic approach  Exclusive access to Evogene’s CPB technology platform  Commercial partners in place for cultivation and production (IL & EU)  Initial commercialization expected in 2022   Infrastructure in place – from seed to sale   Leading academic partnerships for unique variety development 
 
 THANK YOU